SimpleSearch - Line and FST details


Line specific information

 
Line ID 847D03
Vector Used pAC106
Line Availability available as T3 set from NASC (N481255)
Segregation Analysis 50:40:28
Confirmed for Hit At2g25360
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g25360

 
Sequence (A. th genome BLAST matches underlined) 
>20-K025837-022-847-D03-8409
ACATGAAGCCANTTACAATTGAATATATCCCGATATGGGATCCTCCCTATAGTGAGCACG
ACTTGTCTGATCCCCAAATCGAAGGATTCTCTTAACCCACGAATCAGTGCCATGCTCTCT
ACTTCTATGCAGCTAATCTTAGTGTCGCTTAGTGATTCTTTAATCTCATACAACAAATTC
TCCTTCTCATCGCAAATCGCAACTCTAATCCAGACTTCACGGTCTTTTCCTTACCTTCCA
CCACCAAACCCTTGGCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CU590036 [GenBank]
Graphic View Graphic view of gene At2g25360
Predicted Position of Insertion Chr2:10804324 - go to primer design
BLAST e Value 8e-109
Hit Clone Code (BAC ID) T22F11
Hit Gene Code At2g25360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CU590036 [GenBank]


Last Updated on 10.06.2021 13:37