SimpleSearch - Line and FST details


Line specific information

 
Line ID 848H09
Vector Used pAC106
Line Availability only available from NASC (N481405)
Segregation Analysis 50:31:29
Confirmed for Hit At1g68200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g68200

 
Sequence (A. th genome BLAST matches underlined)
>72-K025835-022-848-H09-8409
CATTTAAATTGAATATATCCAGTTCCCTTTCGGAGGCTTAAATTCTGAGTTCTCTGGGTG
GATTTTGTGAAACAGAATTGTCACCGGGAAAAATGAAAAACATAGTCGCGCCGTTTATTT
AGAGCGGAATCTCCGCCGGAAATTCATCCAGTGGCGGCGTCGTTTCTTCTTCTCTCTATT
CTGATCATCTCTAGAAGGATACTCGCAACATAATGCAACACCGTCCAGATATGCTGAATC
GCCAGGCGTTGTGTTACACGCATCTCCATGAAGTTTCTCTTGAAGCAGAAGCGCTTCTTC
TAAAGAACACTGAACTCCGATCGATGAATCTTCGTCTCAAGAATGAGCTCAACAGTCTCA
TCAGATCTTCGATCCAGAACCGATTTGATCATCGATCTCCGCTTCGGATGCTTAGCAATC
TTTCGATCGGAGGTAATGACGCCGACGAAGTGGAGAATCAGAACCGTATGGGATCCTCCC
TATAATGA
GenBank Accession CR401738 [GenBank]
Graphic View Graphic view of gene At1g68200
Predicted Position of Insertion Chr1:25562059 - go to primer design
BLAST e Value 2e-177
Hit Clone Code (BAC ID) T22E19
Hit Gene Code At1g68200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Zinc finger C-x8-C-x5-C-x3-H type family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40