SimpleSearch - Line and FST details


Line specific information

 
Line ID 848H11
Vector Used pAC106
Line Availability only available from NASC (N481407)
Segregation Analysis 50:44:39
Confirmed for Hit At1g07520
Parent of DUPLO pair 12138
Parent of pair(s) none

Gene hit At1g07520

Sequence (A. th genome BLAST matches underlined)
>88-K025835-022-848-H11-8409
AGCCATTTACATTGAATATATCCTGGATGTAAGCGAATTCTTAGGTATAGAAGAGTGACT
CTGCGATGTCGCTGATGACTTGCTGCGACATTTCCTCGAGTTTGTTGAATATCCTAAGAA
TCATAGAATATAGACTGCTTCTCAACGAAACTCTCTTCCATAAGGAGCTGGTTTACATAT
TTCAAAAGGGTGTTTTCGGAATCAATCTCATCAGCTGGTGGAGAAAAGTGATGATCTTGA
TCTGGAACCCAAATCGAAGGTTGGTGATAGTATTGATCCATCCGAAGATCAAAATCACTA
GAAGAAGGAACACCGAATCCAAGATCCGGAATCGAAGTTGGTAAGAAACTCACATCGTAG
CCGTTGACCACACCTGAGTAATTCGATTCCATCATCCAAAAAAAGAAACTCTTTTTTATT
TTTTTGTAAAACCCTAAATTCCCTGAATTTGGCTTCTCGACATACAAAGAACAGAGTTTT
ACAAAAGATTCAGCAACGAAATCTGAATC
GenBank Accession CR401739 [GenBank]
Graphic View Graphic view of gene At1g07520
Predicted Position of Insertion Chr1:2311444 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F22G5
Hit Gene Code At1g07520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Lee et al. 2008, scl31-1]
Other FSTs Supporting this Hit CR401739 [GenBank]


Last Updated on 31.08.2016 09:40