SimpleSearch - Line and FST details


Line specific information

 
Line ID 851B02
Vector Used pAC161
Line Availability only available from NASC (N481614)
Segregation Analysis 50:30:19
Confirmed for Hit At2g02860
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g02860

 
Sequence (A. th genome BLAST matches underlined)
>10-K025842-022-851-B02-8409
AACACTGATGCTTTAAACCGAAGGTGGCAAACGACGATCTGATCCCCGGGTATGGGATCC
TCACTATAGTGAGATTAAGCAATAATTTCCATTGATTAACTGAGCCATGCTGCACCTTCC
CCCCTGCACGGTGATTAAATAGGCATCAGAGTGATCCTTCTGCAACTTTATAAACCTCAT
CACTTCCGATGGAGTTATAATAAAAACTATCTATATCTAACATCATACCAACCCACCTGA
TACATATATGACCGATATGAAATCATTTGAACGCAGGTATGGGATCCTCCCTATAGTGAG
NNNNNNNNCNAANNNNNCNTNNNTANAACTATGGGATCCTCCCTATAGTGAGGCCTANTA
ATCCTGCCAACATCCCTATAATGAGACCTAATACTCACATGGCATATACTGATTTGGAAC
TTAAATCTAATATTTTTTTCCCCACTCTACCGATTTCATTAGAATTTAAAAAAAAAATAG
ACTAAAACTGAATTTCAAAAATATTTTAAA
GenBank Accession CR401969 [GenBank]
Graphic View Graphic view of gene At2g02860
Predicted Position of Insertion Chr2:831440 - go to primer design
BLAST e Value 2e-04
Hit Clone Code (BAC ID) T17M13
Hit Gene Code At2g02860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sucrose transporter 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR401969 [GenBank]


Last Updated on 31.08.2016 09:40