SimpleSearch - Line and FST details


Line specific information

 
Line ID 852G02
Vector Used pAC161
Line Availability only available from NASC (N481770)
Segregation Analysis 50:14:11
Confirmed for Hit At1g68510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F13N6

 
Sequence (A. th genome BLAST matches underlined)
>15-K025757-022-852-G02-8409
GNAGCCATTTACAATTGAATATATCCTGAGTATGAAGCCAAGTATGAAGCCATCGATTGA
CCGATAACTACAAGTTATTAGTTATACCAAAATGTTATGTAAAATATTAAAGAGAATTGA
TTGTATACTGATTTTCAAATATATTTGTCAAATCCACCGTATGGGATCCTCCCTATAGTG
AG
GenBank Accession CR402167 [GenBank]
Graphic View Graphic view of sequence CR402167 of line 852G02
Predicted Position of Insertion Chr1:21157882 - go to primer design
BLAST e Value 6e-48
Hit Clone Code (BAC ID) F13N6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g68510

 
Sequence (A. th genome BLAST matches underlined)
>15-K025844-022-852-G02-8409
NNTTTGGAGGTATTCGGACATGAGCCTTTACATTGAATATATCCTGATAATTTAAACCGA
AGGCGGGAAACGACTATCTGATCCCCGGGTATGTTATCCTCCCTATAGTGAGATGTACAA
TATTCCCCTCTAGTGAAAGTAACACTGCTTTTCTGTATATGTTTGTATAAACGCCTGTAC
TGAACCAATCTTTTTTCTGAGATTTTCTCCCATACTTGAAATCAGTTAAGTAATTCCATC
TCTTTCACTTACCACTCATGAATAACTTCTTCCTTATAAATTCAAATTGTTCACAACTTC
CTTGAGTTCCATTTCCGAACACAAACACACATCATACGTATATTTGTCACTAATAAACAT
ATAAAGGAATATGAGAATCAGCTGCAACGGGTGTAGGGTTCTACGCAAAGGTTGCAACCA
AGATTGCACCATTCGACCATGCCTTCAATGGATCAAATCCGCAGACTCTCAAGCCAATGC
TACACTCTTCCTTGCTAAGTTCTACGGTCGAGCCGGTCTTCTTAACCTCATCGAA
GenBank Accession CR402168 [GenBank]
Graphic View Graphic view of gene At1g68510
Predicted Position of Insertion Chr1:25706906 - go to primer design
BLAST e Value 4e-157
Hit Clone Code (BAC ID) T26J14
Hit Gene Code At1g68510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOB domain-containing protein 42
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40