SimpleSearch - Line and FST details


Line specific information

 
Line ID 854D01
Vector Used pAC161
Line Availability only available from NASC (N481925)
Segregation Analysis 50:50:30
Confirmed for Hit At2g46020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g46020

 
Sequence (A. th genome BLAST matches underlined)
>04-K025755-022-854-D01-8409
TAAAGTCCCGTGGGATTTCGTCTGCAGAGTGAACTCGATACTTGGCTGCCATCTGTTACA
CGCATATATTATGTTGATATGGAATCCTCCCTATGGTGAGGGCAGCGCGACTAACATTCT
ACCTAGCTAGAGTCAAAGTTAAGCTTAGATAATGGATATAAGAGGCTTGTGGGTTCTCTC
CGAACTGAGTGAGAGAGTTATGAGTTGTCAAACCTGGAGACCCACCTACTCCCTTGGTTC
TAACCATTGATTCTGTGAAAAAACTTAAAAGAGTCTATCAGAAACACCAACCTTCCAATT
CACCAGAACAGCATTGGGAACGATGATGAGATGCGGTCCATAATTCCCTTTAAACTCCAT
AAGGTAAGCAATCAGTGCCATTACCCGTATGGGATCCTCCCTATAGTGAGGGGGGGGG
GenBank Accession CR402362 [GenBank]
Graphic View Graphic view of gene At2g46020
Predicted Position of Insertion Chr2:18927720 - go to primer design
BLAST e Value 5e-101
Hit Clone Code (BAC ID) T3F17
Hit Gene Code At2g46020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transcription regulatory protein SNF2, putative
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03