SimpleSearch - Line and FST details


Line specific information

 
Line ID 854D06
Vector Used pAC161
Line Availability only available from NASC (N481930)
Segregation Analysis 50:6:6
Confirmed for Hit At5g13180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g13180

 
Sequence (A. th genome BLAST matches underlined)
>44-K025846-022-854-D06-8409
GNAGCCATTTACATTGAATATATCCTGCCGCCGCTGCCGCTTTGCACCCGGAGAAAGCTT
GCATGTTGGTTTCAACACGAAACTGAGCCGGTTAGGCACATAATTTCCATTGAGAACTGA
GCCATGTGCACCTTCCCCCCAACACGGCGAGCGACGGGGCAACGGACTGATCCACATGGG
ACTTTTAAACATCATCCGTCGGATGGCGTTGCTCAGACAACCACTCCATCCGTGAGATCA
CCCGACCCACCGGGGAAGCGCGCAAGACGATCGCAAAGTATTTGAACGCATGTAGGGGAT
CCTCCGTATACTGAGATCAGATTCCATCCTACTGATGAAGAACTTGTGGTTCAATACCTT
AAGAGGAAAGTTTGTTCTTCTCCTTTGCCAGCTTCAATCATCCCTGAGTTTGATGTTTGC
AAAGCTGATCCTTGGGATTTACCTGGTAAAGCTTTCTGATTCTTGCTATATTTANTAAGT
TTTCAATTTAAAGTCTCTGTGACCTTTAAGGCTCATAAGATTCTCTTAT
GenBank Accession CR402370 [GenBank]
Graphic View Graphic view of gene At5g13180
Predicted Position of Insertion Chr5:4196418 - go to primer design
BLAST e Value 1e-110
Hit Clone Code (BAC ID) T19L5
Hit Gene Code At5g13180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 83
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR402369 [GenBank]


Last Updated on 14.10.2014 10:23