SimpleSearch - Line and FST details


Line specific information

 
Line ID 857H06
Vector Used pAC161
Line Availability only available from NASC (N482266)
Segregation Analysis 50:31:22
Confirmed for Hit At3g02130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g02130

 
Sequence (A. th genome BLAST matches underlined)
>20-K118445-0022-857-H06C-8409
TCATTGAATATATCCTTTGAGAAGCTCCTGTTGTTTACAGCTTTGGGTGTAATCCCTGAT
TTTCTCAACAATACCACAAGCCATTGTCCTCCTGTTGTTTACTTTGACAGGTTTTCTATT
GAATCTTACAGCGACCCGTCGTCTGTTTATCTCTCCTTCTTTACCGAGAAGGCTCAAGTT
GGAACTTCCCTGATAGATCTTGGAAGTGATGGAGGTCCGGCCGTGTTTCATAATTTTGCA
GACAACAACTTCACTGGTACTCTCAAGTCTATACCACTTGCACAGGAGCGGTTGGGAAAG
CGAGTCTCTTACATATTTTCTGCTGGAGGGAATCGGTTGTACGGGCAATTTCCGGGAAAT
CTGTTTGATAACTGCGACGAACTCAAAGCTGTTTATGTCAATGTAAGCTTCAACAAGCTC
TCAGGTCGGATTCCTCAGGGACTAAACAACATGTGCACTTCTCTTAAGATTCTTGATGCC
TCGGTGAATCAGATCTTCGGGCCAATCCCAACAAGTCTCGGGGATCTAGCTTCACTTGTT
GCTCTTAATCTGAGCTGGAATCAGTTGCAAGGTCAGATACCGGGTAGCCTCGGGAAGAAG
ATGGCAGCTTTTGACAT
GenBank Accession HG969157 [GenBank]
Graphic View Graphic view of gene At3g02130
Predicted Position of Insertion Chr3:382131 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F1C9
Hit Gene Code At3g02130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation receptor-like protein kinase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR402761 [GenBank]


Last Updated on 07.07.2016 14:03