SimpleSearch - Line and FST details


Line specific information

 
Line ID 859H07
Vector Used pAC161
Line Availability only available from NASC (N482459)
Segregation Analysis 50:10:5
Confirmed for Hit At2g29680
Parent of DUPLO pair 2509
Parent of pair(s) none

Gene hit At2g29680

 
Sequence (A. th genome BLAST matches underlined)
>56-K025971-022-859-H07-8409
GTTCATGAAGGACACNCTCGGTCTCTTGTGATCAAGTAATCCATTTCATCTGCAATTATT
AGCCTGCAGATAAAGTTTGAATGAGAAACAGCGCAACAAATTATATCTACTTATCTAGCA
GGTCATCATATCACAAGACCAAAAACAAAAGAAAAACCTACATCATCTTTGATCTGGATT
GTTGTTGCTTTTGAGAAAACAATCTCTGAAGTTGTTGTAGAGGTGAAAATGAACCATTAG
CTTTCTTCCCGGACTCATAGTTACCAAGTATCTAAAAACAAAATAACTCAATTAACAACT
ATACTGAAATGATGAGACCAATAACTTCGAGTAATTTTCGACTGGATAAGGTCTTACCTT
GGAGAAAATATCCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR403021 [GenBank]
Graphic View Graphic view of gene At2g29680
Predicted Position of Insertion Chr2:12690841 - go to primer design
BLAST e Value 2e-177
Hit Clone Code (BAC ID) T27A16
Hit Gene Code At2g29680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cell division control 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR403020 [GenBank]


Last Updated on 31.08.2016 09:40