SimpleSearch - Line and FST details


Line specific information

 
Line ID 862B04
Vector Used pAC161
Line Availability available as T3 set from NASC (N482672)
Segregation Analysis 50:14:9
Confirmed for Hit At1g74060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g74060

 
Sequence (A. th genome BLAST matches underlined)
>26-K025976-022-862-B04-8409
CATTTATTCTCGGCCGGAAAGTCTCTTCTTGATTATCGTCCAGGGATTGCAACAGAGAGA
AAGTAACGATGCCGGCGAAACAGAGGACAGCTAAGGTCAACAGGAATCCTGATCTGATCA
GGGGAGTTGGTAAATACTCAAGGTCTCAGATGTATGGGATCCTCCCTATAGTGAGACNAA
TTNNTCNNN
GenBank Accession CR403284 [GenBank]
Graphic View Graphic view of gene At1g74060
Predicted Position of Insertion Chr1:27851366 - go to primer design
BLAST e Value 2e-81
Hit Clone Code (BAC ID) F2P9
Hit Gene Code At1g74060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L6 family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37