SimpleSearch - Line and FST details


Line specific information

 
Line ID 862G11
Vector Used pAC161
Line Availability only available from NASC (N482739)
Segregation Analysis 50:33:30
Confirmed for Hit At4g13250 At5g67420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g13250

 
Sequence (A. th genome BLAST matches underlined)
>87-K025977-022-862-G11-8409
ATGAAGCCTTTACAATTGAATATATACTGGAATAACTGTATATGAATAGTATGGGATCCT
CCCTATAGTGAGAAGCCGTTTCGTGCTTACGTCGACCCCCCTACTGCTTCCTCCAAACTT
TCTTCTCACCGTTGGTAGACAATTCCGATTCTGATTAATATCGAACAATCTATCTTTTGG
GTCCCGATCAAGCTCCTTCATTTAGCTTGCTTGCTACGTTATCCTCTTGAATCAGCTTCA
AGCTTATACGTTAACCCTCTCTTCTTCGATAACTATGACTACTTTAACGAAGATTCAAGC
GTATGGGATCCTCCCTATAGTGAGGGCCGNGCTGGTCTCCTGTCCTTTATCTCCCCTGTT
GGGGA
GenBank Accession CR403368 [GenBank]
Graphic View Graphic view of gene At4g13250
Predicted Position of Insertion Chr4:7686927 - go to primer design
BLAST e Value 2e-14
Hit Clone Code (BAC ID) F17N18
Hit Gene Code At4g13250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g67420

 
Sequence (A. th genome BLAST matches underlined)
>87-K025976-022-862-G11-8409
ATGAACCATTTACAATTGAATATATCCTGACCCATTTGAACAGACAGTTGACCTCTACCG
AGGAATGCCACCAGCCGATTCGCGGTTCTGTCATCCCCCCTACTGCGAGCAACAAACATT
CTTCTCACCTTGGTAGACAATTCCGATTCTGATTAATATCGAACAATCTATCATTTGGGT
CCGAATCAAACTCCTTCATTTAGCTTGGTTGCTACGTTATCCTCATACATCACCTTCACA
TATGATACGTACCCTCTCTACTTCCAGAACTATGACCACTTTAGCGAAGATTCAAGTGTA
TGGGATCCTCCCTAAATCGAGAGCCGTGCTGGTCTCATGTCCTTTAACTCCCCCGATGGA
AATGCCCAAAATCCGGGCACGAAAACCACACCACAA
GenBank Accession CR403367 [GenBank]
Graphic View Graphic view of gene At5g67420
Predicted Position of Insertion Chr5:26905569 - go to primer design
BLAST e Value 5e-05
Hit Clone Code (BAC ID) K8K14
Hit Gene Code At5g67420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOB domain-containing protein 37
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03