SimpleSearch - Line and FST details


Line specific information

 
Line ID 863D08
Vector Used pAC161
Line Availability only available from NASC (N482796)
Segregation Analysis 50:30:28
Confirmed for Hit At4g38160
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g38160

 
Sequence (A. th genome BLAST matches underlined)
>60-K025978-022-863-D08-8409
ATTGAATATAGCCGGAAAGGCTCTCCTCCAGGTAAATTCCTCTCTACTTCCTTGTTAAAG
CTCGAATCATCTCTAAGTTAAGCAAAATTGGTGTGTTGTAGTGGCGTTTATATGGAGGTG
ACAAATACGAGCAGCATCATGTGGTTCTTCAGGGACAAAGGTTTCGATGATCCGAGTATC
GACAAGATGTTGAGAAAATGCAAACAGTTGGAAAAGGCTCAAAGCGATGTGGCATCAGAA
AACTGGGACTACCTGAGTAACATTGTTGGTATCCAAGAGAGAAAACTCCCTTACATCGTC
TCTCGATGCCCCAAAATCCTGACTTTACGCCTCGATGAGAGACTCATCCCGATGGTCGAG
TGCCTCTCCAGTCTTGGAAGGAATCCTCGGGAAGTTGCTTCCGCCATTACCAAATTTCCT
CCAATACTCTCTCATAGCGTGGAGGAGAAACTCTGTCCCCTTCTTGCTTTCTTTCAAGCG
TTAGGTGTGCCTGAGACTCAACTTGGCAAAATGATACTTT
GenBank Accession CR403449 [GenBank]
Graphic View Graphic view of gene At4g38160
Predicted Position of Insertion Chr4:17902307 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g38160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03