SimpleSearch - Line and FST details


Line specific information

 
Line ID 863H12
Vector Used pAC161
Line Availability only available from NASC (N482848)
Segregation Analysis 50:42:37
Confirmed for Hit At2g24740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g24740

 
Sequence (A. th genome BLAST matches underlined)
>96-K025978-022-863-H12-8409
CGATCCCCATATGACCCTCCACAAACCCCTTGGGGATGGGGGGGCTTCAGCATCGAGCAA
TCCTATAAACCAGATGCCGGTCCTAGTACGGGCCCAGCCCAAAGAGAAAGATCATATGCT
GTTAATGAAGAACCCCACGCAACATCAATACCTCCTCATGCACCGCCACAAACCCTTTGG
CTATTACATAACTTCAACATTGAGGACTCTTATGACCCAGATGCCCGTCCTAGTACTAGT
CCAATAGAGGGAGGGGCATCCCATGAACTCTATGAAGACCCCCACACAACATCAGCCCCT
CCTCATGTAA
GenBank Accession CR403524 [GenBank]
Graphic View Graphic view of gene At2g24740
Predicted Position of Insertion Chr2:10531965 - go to primer design
BLAST e Value 6e-85
Hit Clone Code (BAC ID) F27A10
Hit Gene Code At2g24740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SET domain group 21
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23