SimpleSearch - Line and FST details


Line specific information

 
Line ID 864C02
Vector Used pAC161
Line Availability only available from NASC (N482874)
Segregation Analysis 50:19:9
Confirmed for Hit At3g02885
Parent of DUPLO pair none
Parent of pair(s) 3800, 7170, 90543, 90546

Gene hit At3g02885

 
Sequence (A. th genome BLAST matches underlined)
>11-K025980-022-864-C02-8409
ATTATCAACCACTTACTACTCTGTTTTCAACTGTTGCAACTACCTTGCCGATTTGTCACC
ACACTTTTTTTGCGACTATCTGATCTTTGAGATCTTGATGTTCATGCTTATAATTCCCAC
CATACAGTATACTACAAAACTGACATTTCACAAAATAAACACCATTATTGTTACTTTACA
GTTTATTTATCAACATTATCAATAATTAGTGATTACTAAATTAATATGATCATATGAAAC
AACAAAAGTTTTGAGTCTGTATGGGATCCTCCCTATACTGAGACGTTGATGATGTTTGTA
TGTGGAAGGGGGGGGGAATGTAACTCCCCCATTTTGAACACCCCCCACTTGTTATTGTAC
CAATTCTAAATAAAA
GenBank Accession CR403557 [GenBank]
Graphic View Graphic view of gene At3g02885
Predicted Position of Insertion Chr3:638402 - go to primer design
BLAST e Value 9e-78
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02885 [TAIR] [MIPS] [SIGnAL]
Gene Annotation GAST1 protein homolog 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23