SimpleSearch - Line and FST details


Line specific information

 
Line ID 867C03
Vector Used pAC161
Line Availability only available from NASC (N483163)
Segregation Analysis 50:15:14
Confirmed for Hit At4g37120 At5g62400
Parent of DUPLO pair 2380
Parent of pair(s) 1289

Gene hit At4g37120

 
Sequence (A. th genome BLAST matches underlined)
>19-K026112-022-867-C03-8409
TTCACCGAACAATATGAAGAATGTTTCTATAATTGCAGTCTTCCCGACATGATCTATGGT
CTCCTCCCTATATTGAGGTATGGGATCCTCCCTATAGTGAGACTGTAATACTGGTCCCTC
TCCGGCGGATGTTTTACAAATACGGAAATACATCGTTCCTCACATACCTGAGTATATGTC
TGACGCTCCTTGGTATCTCCAGTCTGAACAGCCGGTATATGCGAAAATTCTTCTTTCTCT
TGCTTCTCTGCATTGTCTTGGTTGAGAACATTCACACTCATACTCTGTGATTTTTTTTTG
NATGGGATCCTCCCTATANTGAGNNNNNNN
GenBank Accession CR403935 [GenBank]
Graphic View Graphic view of gene At4g37120
Predicted Position of Insertion Chr4:17486840 - go to primer design
BLAST e Value 5e-64
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g37120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pre-mRNA splicing Prp18-interacting factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g62400

 
Sequence (A. th genome BLAST matches underlined)
>19-K026079-022-867-C03-8409
TCCTTCCTAAATCCATTAACACTACCACTCCAAAAGAGCTTTTATTAATACACCTTACTC
GTGACCGGATTCGCATAGTTCACGAGCTTCCGAGTCAAAAACACTCTAAAACAAAACCAT
GACTTTGTTCCATAGACTCGATCTCATCGATCCGTATGGGATCCTCCCTATAGTGAGACT
GCTTCTCCGCCTTGTCTTGGTT
GenBank Accession CR403934 [GenBank]
Graphic View Graphic view of gene At5g62400
Predicted Position of Insertion Chr5:25054401 - go to primer design
BLAST e Value 2e-69
Hit Clone Code (BAC ID) MMI9
Hit Gene Code At5g62400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BCL-2-associated athanogene 7
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03