SimpleSearch - Line and FST details


Line specific information

 
Line ID 868E09
Vector Used pAC161
Line Availability only available from NASC (N483289)
Segregation Analysis 50:9:5
Confirmed for Hit At2g40940
Parent of DUPLO pair 2357
Parent of pair(s) none

Gene hit At2g40940

 
Sequence (A. th genome BLAST matches underlined)
>69-K026113-022-868-E09-8409
AAGCCATTTACAATTGAATATATCCTGACTTTTTCGATCACATGATAATATATGTCAAAG
GCGGGAAGAGACTATCTGATCCCCCGCTATGGGATCCTCCTTATGATGAGTCGTTCCCCT
CAATGAAGAACCTATCCTCGAATCTGATTAGGTCTGCAAACTCACTAATTTATGCTATTG
ATGATTAGAGCTTTTCATGCTAGTCATTCTCAACATCCTGTGCTCCGCTGTGAAATTTAC
CAAGGAAAGATAAATCTCCATAATAACCTCTATCAGGATCCCCGAGTCCTTATCAGAATT
ACCATCTCCTGAATTTTTTCCAGTTCTCAGTGACAGTCCCTTCTACCTATGTGTGCAGGT
TAAACCCAATCTACAAATTACTAAACTACAAAGTTAAGCTTCTTACTGTGTTCTTACTGT
TATAATCATGGTGCANGTGAATTACACAGGCTGTGGAATTCNTACACCATACATTCCTTT
GATCTTTACCAAATTTGTA
GenBank Accession CR404102 [GenBank]
Graphic View Graphic view of gene At2g40940
Predicted Position of Insertion Chr2:17085423 - go to primer design
BLAST e Value 3e-102
Hit Clone Code (BAC ID) T20B5
Hit Gene Code At2g40940 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene response sensor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g42180

 
Sequence (A. th genome BLAST matches underlined)
>69-K026080-022-868-E09-8409
GACATGAGCCATTTACATTGAATATATCCTGACGCTTACCTGAATAATGAATCTATCTCA
CACTCTTCTTTTATGTGCATTAATCCACAATCTCGACTATTTATAAGGGACTTTCTTGAC
GTTTATAACCTTACCAGTCCCTGTTATTTACTTATATGAATATGACATAACATTTTGTCG
TATGGGATCCTCCCTATAGTGAGANGNNNGGGTCNNNNNTCTTTGCTCTGNTGACAGTTC
TNTCTCGGGGGGTTGACTCTCCTTAGAAATGATCGGCAAGGATCGGCGACCCCTTATCGG
AATTACCATCTCCTGAGTTTTCTCCTCTACTCAGTGAGAGACCCTTCCAATTATGTGTGC
AGGTTANACCCAATCTACAAATTACTAAACTACAAAGTTAACCTTCTTACTGTGTTCTTA
C
GenBank Accession CR404101 [GenBank]
Graphic View Graphic view of gene At2g42180
Predicted Position of Insertion Chr2:17581645 - go to primer design
BLAST e Value 2e-63
Hit Clone Code (BAC ID) T24P15
Hit Gene Code At2g42180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23