SimpleSearch - Line and FST details


Line specific information

 
Line ID 872B07
Vector Used pAC161
Line Availability only available from NASC (N483635)
Segregation Analysis 50:47:35
Confirmed for Hit At2g15370
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g15370

 
Sequence (A. th genome BLAST matches underlined)
>50-K026084-022-872-B07-8409
AAGTATTCAAAGTCTATTTAACTGATCTATGATTGACACATAGAAATGAAGCTATATAAA
AGTCGTATGGGATCCTCCCTATAGTGAGACGGATGACTCCCCCCATCTGTGGGGCCCGTT
TTTTGCCGCCCCCGTTTGGGTCCCGCTGTGGGGGTTCCTCCCTNTGGGGGGTNCNGGGNN
TNCTTGGNNNNNCCCTCTTNNGGTGGGGCTTCCNCNNCCCNCNNTNCTCTTCTCCNTNNT
CTTNTNNTNCCNNNNGGCTCGTCCTCTCTGNNNNTTTTCCCCTTTTGCNGGCCTCCNCCC
GTCTCGNGCGTTTGCTGCGTCCNTGTTGGTCTTGNGCNNTGTCCTCCCCTGCCTCCTGTG
GGGCGGCGCTGCGCGCTTTGTCTCCGGCCGGTCTGGGGTCTGCCCTCCTNGTGGCGGCGG
GCCCGCTTTGCTTCGCTTTTTGTTTCCTC
GenBank Accession CR404569 [GenBank]
Graphic View Graphic view of gene At2g15370
Predicted Position of Insertion Chr2:6699891 - go to primer design
BLAST e Value 2e-23
Hit Clone Code (BAC ID) F26H6
Hit Gene Code At2g15370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation fucosyltransferase 5
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03