SimpleSearch - Line and FST details


Line specific information

 
Line ID 873G07
Vector Used pAC161
Line Availability only available from NASC (N483791)
Segregation Analysis 50:36:34
Confirmed for Hit At5g17420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g23370

 
Sequence (A. th genome BLAST matches underlined)
>55-K026519-022-873-G07-8409
TTGAAATTGAGATATCTAAACTCAAGGCGGGTAAACGAAGATGTGATCCCCGGGTACGGG
ATCCTCCCATATACGTGATTCCATACCTGAGGGGGATTCTTCCAGGAACGGCCTTCCGCG
TATGGAATCCTCCCGTTGTTGAAATCCTCTATAACGCCCTATCCTTTGAACATCGTACTG
GATTAACTTTCCTGGATACCTTCCTCTACTTCCATAGGAACAATTTACGACACTACCTTC
CCCACTTTAGCCCCCATAAAAAGAAAAAAAAAAATGTCTGCCATCCTCCCTATATTGACA
CTGTTATTGGCATCCATCTTCTCTTTGCTTTTTTTAAAATCTAACCCGTTTATGTCCGCA
ACCATATGATCTGACGATTCTACGTAGTCCTTCAGGGATGAACCCATACTCCTTTTCGAC
TTCTGAAACTTTTTCTGTATGGAATCCCCCCTATCCCGCCCCACATTATGTAGGCCTCCA
TCCACAAAATTTTTTCAATTCAAAAATGTAAATT
GenBank Accession CR404860 [GenBank]
Graphic View Graphic view of gene At4g23370
Predicted Position of Insertion Chr4:12211179 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) F16G20
Hit Gene Code At4g23370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation carboxyl-terminal peptidase
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At5g17420

 
Sequence (A. th genome BLAST matches underlined)
>55-K026465-022-873-G07-8409
GTATGCCTGCCTTTGTTGAGGGCCTCTAAAATGCCCTTACCTTTGAATATCGTACTGGAG
GAACTCTATTGGGTACCCTCCTCTTCTCCTTTTGGAACATTGTATCGACACTACCTCCTC
CTCTTTAGCCCGATGAATAGAAAAAAAAAAACGTCTGCCATTGTGCTGATTTGGACAGTG
TTATTGGCATCTATCTTCTCTTTGCTTTTTTTAAAATTTGATCCGTTTATGCCCCCAACC
ATAGTACCTGACACTTCCAAGTGTGGACTCAAGTGATAAAGCAAAATCTTTTTCGGCTTC
TAAAACTTTTTCCGTATGCGATCCTCCCTATAATCAGCCCCACCCGCCACATTCTCCGCG
CACNGAATTTTTTCAATTCAAAAATGTAAAT
GenBank Accession CR404859 [GenBank]
Graphic View Graphic view of gene At5g17420
Predicted Position of Insertion Chr5:5737234 - go to primer design
BLAST e Value 1e-24
Hit Clone Code (BAC ID) T10B6
Hit Gene Code At5g17420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cellulose synthase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03