SimpleSearch - Line and FST details


Line specific information

 
Line ID 876D09
Vector Used pAC161
Line Availability only available from NASC (N484045)
Segregation Analysis 50:46:42
Confirmed for Hit At3g55770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g55770

 
Sequence (A. th genome BLAST matches underlined)
>68-K026468-022-876-D09-8409
AGCCATTTACATTGAATATATCCTGCCAATGAGTAACCATTAGAACGGCATGCAGAAAGA
ATGCATGATTCCAAGCAGAAACAAAACTACATACGTGACTGAAAGTTCTTGTTGAAACTA
CCACTCTCCTTAAAGAGCTGCTCAAAATGAGGCTTACAGTATGGGATCCTCCCTATAGTG
AGTCCAAACATCATCCGTCGGATGGCGTTGCGACAAAAGCAATCTATCCGTGAGATCACC
CGACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTATTTGAACGCACGTACGGCATCC
TCCCTATAGTGAGTCNTATTNNNNNNNNNN
GenBank Accession CR405187 [GenBank]
Graphic View Graphic view of gene At3g55770
Predicted Position of Insertion Chr3:20704253 - go to primer design
BLAST e Value 9e-44
Hit Clone Code (BAC ID) F1I16
Hit Gene Code At3g55770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GATA type zinc finger transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g53600

 
Sequence (A. th genome BLAST matches underlined)
>68-K026522-022-876-D09-8409
ATTTCCCTTGAAAACGGATCCATGCGCACCTTCCCCCATGCACGGTGAACGACTGTTCAA
AGGAATGATCCCCATGGGACTTTTATCCATCATCCGTTCGGATGGCGTTACGACAAAAGC
AATCTATCCGTGAGATCACCCGACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTATT
TGAACGCAGGTATGGGATCCTCCCTATAGTGAGACCTATTGGTAATTACTCTTTCTTTTT
CTCCATATTGACCATCATACTCATTGTTAATCAATATATATTTCCCCCACCTNANNACAT
AAACAAAAAATTATTTTCTTTTAAAATCTAATACAAAAAAAATCTCCTCCAAATATTTTT
TCCTAATCAAAAAAAAAACTAATCCCCAATTATTTTTTCTTTTATTAAACTTCTTAAAAA
CACTTCCC
GenBank Accession FR816961 [GenBank]
Graphic View Graphic view of gene At1g53600
Predicted Position of Insertion Chr1:20003788 - go to primer design
BLAST e Value 2e-04
Hit Clone Code (BAC ID) T3F20
Hit Gene Code At1g53600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03