SimpleSearch - Line and FST details


Line specific information

 
Line ID 879D07
Vector Used pAC161
Line Availability only available from NASC (N484331)
Segregation Analysis 50:44:36
Confirmed for Hit At5g07370
Parent of DUPLO pair 2340
Parent of pair(s) none

Gene hit At5g07370

 
Sequence (A. th genome BLAST matches underlined)
>34-K118445-0022-879-D07C-8409
CATTTCATTGAATATATCCTGACTCGAAACCTGACTCTGCTTTTGCCTCGAGTGTTTACG
GCGGTTCCCACGGGATCTTAACGCAGTTGCTGGAACTCAAGACCTGGTTCGAGAACCAAA
CGCTCTACCATTTCAACTCTTGTTCGATTTTAATGGTCTATGAGAATGAATCCATCTTAA
AGGGAAATGATGATGATGCTAGACCACAAGTCAAGCTGGTGGATTTTGCTCATGTTCTTG
ATGGTAATGGTGTCATTGACCATAACTTCTTGGGTGGTCTTTGCTCTTTCATAAACTTCA
TTCGTGAGATTCTTCAGAGCCCAGATGAGTCTGCAGATTCTTAGATTTAAGTTAATTTGT
TTGTTATGGCTTTGGCTGATTCCAATTTTTGGATATAAACTTATGTTTCCTTCACATATG
TACTTGATTACCTAAAGAGCAGAATACATTCGTACTCTTTTCTCAAAGAGTATTCCATTT
CTAGGCATATAAAAAAATTCCATATTTGAACTTTACTTTGAATGTGACTTGTACAGCTAA
AAAAGTTTAGCGCCAAAAGAGGAAATAATTCACACTAATAGTAAATTTCGTAAATAATTA
AGAGTTTGTTTGCAGTGAGACCCCCAAATA
GenBank Accession HG969168 [GenBank]
Graphic View Graphic view of gene At5g07370
Predicted Position of Insertion Chr5:2331790 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2I1
Hit Gene Code At5g07370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation inositol polyphosphate kinase 2 alpha
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR405559 [GenBank] CR405558 [GenBank]


Last Updated on 14.10.2014 10:23