SimpleSearch - Line and FST details


Line specific information

 
Line ID 902G09
Vector Used pAC161
Line Availability only available from NASC (N486577)
Segregation Analysis 50:50:42
Confirmed for Hit At1g80180
Parent of DUPLO pair 2493
Parent of pair(s) none

Gene hit At1g80180

 
Sequence (A. th genome BLAST matches underlined)
>39-K118413-0022-902-G09C-8409
TTTACAATTGAAATATCTCTGAAGCCATCATTGTGTTTCAGACTAGTTCATTTCTTCCTC
CTCTTTCTTATCTCTTTATTAGAAGGCACTTGTGTCTTTTCTAATTAATTTTCTTTTGTC
GTCTTATTATTTCAATTTTATATGTTTTTTTTCTTCTGGTTCTCGAATTATCCAACCAAA
TATAATCGCGATTATCATGTTTAGATGCGTAATCATTGTATTTTATTTGTTACGTATTTT
AAACGGGAGAGAAAAAACTGGGTCAAAGCAGCGGGTAATTATGGGAGTAGAATAGTACAA
ACAACGTTTTTGGGTGGTATGTGTTGAAATTTCAATTATCTTTTTTTTTAACATTAAATT
TAGCTATAGCCACTTAATTATCTGCCAAAAATGATTATTTTTCTTTTCACGTTTCAGGCA
AAGATCATCGCATAGCATATAGTTTTATCAACCATAATCCAGCATGGCTTAATTTTTTTT
AATATTTCTTAAGGAAATCAAGCGTTGGTGACTCGTCGTTGTTCATGCTTGATTTGGTTA
GTTCAAAGTTGAAACTTACAAGTATTAGTAGATGACTGATTCATCGAGTTTTAAAATAAT
AATCACGCAAAACTCGAACCTAATATTTCCTGAAATATAATGGCTCAACTTTGAGAGGTG
TGGATTATTTTATTTTGTAAGATATCTTGCTATATGGCTTGCTGGACCATCCCATTTGTG
TAATGTGGAGACAATCCATTCATGTGCTACTTTTTTCATATGGACAACAAAATTTGCGTG
TTCATATCGTAATTAATCCCCAATTAAATCTACATCGCAAATCTAATATACCCATGCATT
TCAAATCTCGCTACA
GenBank Accession HG969173 [GenBank]
Graphic View Graphic view of gene At1g80180
Predicted Position of Insertion Chr1:30157561 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F18B13
Hit Gene Code At1g80180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR817658 [GenBank] CR935960 [GenBank]


Last Updated on 07.07.2016 14:03