SimpleSearch - Line and FST details


Line specific information

 
Line ID 911F06
Vector Used pAC161
Line Availability only available from NASC (N487426)
Segregation Analysis 50:39:31
Confirmed for Hit At3g02150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g02150

 
Sequence (A. th genome BLAST matches underlined)
>46-K030623-022-911-F06-8409
GCGCTACGACAAGACGTGAAATAGAAGTAAAAGAGGATCAAGAAGAAACCGAAGTCAGAG
CCACCAGTGGCAAAACCGTAATTAAAAAGCAGCCTACATCGATCTCTTCTTCTTCTTCTT
CGTGGATGAAATCCAAGGATCCGAGGATTGTTAGGGTTTCACGCGCCTTTGGAGGCAAAG
ACCGTCACAGCAAAGTGTGTATGGNACCCTCCCTAT
GenBank Accession CT026859 [GenBank]
Graphic View Graphic view of gene At3g02150
Predicted Position of Insertion Chr3:391544 - go to primer design
BLAST e Value 1e-73
Hit Clone Code (BAC ID) F1C9
Hit Gene Code At3g02150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plastid transcription factor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT026861 [GenBank] CT026861 [GenBank] CT026859 [GenBank]


Last Updated on 31.08.2016 09:40