SimpleSearch - Line and FST details


Line specific information

 
Line ID 913A03
Vector Used pAC161
Line Availability only available from NASC (N487555)
Segregation Analysis 50:47:47
Confirmed for Hit At2g45660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g45660

 
Sequence (A. th genome BLAST matches underlined)
>17-K030978-022-913-A03-8409
AGCCATTTACAATGAATATATCCTGGAACACCGAGTATAGGGCCCTGGGGTCGTCTCTAG
ACAGTGTGTAATGAGGATATCACTACACTTAATCAGAGACATAGCTTGAAAAGTCTTGTA
TGGGATCCTCCCTATAGTGAGTCNTATTACTC
GenBank Accession CT026996 [GenBank]
Graphic View Graphic view of gene At2g45660
Predicted Position of Insertion Chr2:18809052 - go to primer design
BLAST e Value 1e-09
Hit Clone Code (BAC ID) F17K2
Hit Gene Code At2g45660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 20
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40