SimpleSearch - Line and FST details


Line specific information

 
Line ID 918A08
Vector Used pAC161
Line Availability only available from NASC (N488040)
Segregation Analysis 50:49:35
Confirmed for Hit At1g16070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g16070

 
Sequence (A. th genome BLAST matches underlined)
>57-K030989-022-918-A08-8409
AGCCATTTACAATTGAATATATCCTATTAATTTTGCATAAATTTCAACTTGGCAAATTCA
TTGATTTTGTAAACCGTTAATTCTGCTAATTTCACAATTCTCTTGTATGGGATCCTCCCT
ATAGTGAGTCCTATTACACTGGATAAATATCCTGTAACTGTGTCCACATTTCCCTTATTT
TCCTCCAACAAATCATTCACTTTTCTCGAACCAGCCATGTTTTTTTTCCCTTTCTGGATG
GATTGCTTTCAAGTATCAAGTTTAGAACTTTCTGGGAGCTAAGTTTATATCTTTATAGAT
TTTGAAGACATGAATCTAGAAACAGGTGTTTGACAATGGTATGGGATCCTCCCTATAGTG
AGACGTATTACTCATTTTTTTTTGATATTCCCCTTTAAGAAGACGAAATTCTCCTC
GenBank Accession CT027319 [GenBank]
Graphic View Graphic view of gene At1g16070
Predicted Position of Insertion Chr1:5513598 - go to primer design
BLAST e Value 4e-89
Hit Clone Code (BAC ID) T24D18
Hit Gene Code At1g16070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation tubby like protein 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT027320 [GenBank]


Last Updated on 31.08.2016 09:40