SimpleSearch - Line and FST details


Line specific information

 
Line ID 918D08
Vector Used pAC161
Line Availability only available from NASC (N488076)
Segregation Analysis 50:46:42
Confirmed for Hit At5g38710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g38710

 
Sequence (A. th genome BLAST matches underlined)
>60-K030990-022-918-D08-8409
AGGCACACCATTTCGAGTGACAATACCTCATCCACCGTTTCTCCACCGAGAGTCCCGTCG
GTCCTCCGACCACCATCATCCCAGAAATCCTTTCCTTTGACCAACCAAAACCAGAAGTTG
ATCTAGATCTCTCCGACCAAGCTCGACTCTTTGCTTCTGTCCCAATCTCCACCCTCCTCC
GCTCAACCGCAATTCTCCATGCCACGTCCATAGGCCCTATGGTCGATCTTGGCTCGTGGC
TCATGAGTTCCAAGCTCATGGACACGACCGTTACACGCGATCTAGTATGGGATCCTCCCT
ATAGTGAGACGTATTACTCACTTCCTTTTGGAACTCCCCCTACGGACATCTAAGTTGACC
TCTCTATTAGAAATTATAACTTACGGTTTTTTTTTTAATTTATAGAAAGAGAAG
GenBank Accession CT027354 [GenBank]
Graphic View Graphic view of gene At5g38710
Predicted Position of Insertion Chr5:15501304 - go to primer design
BLAST e Value 1e-144
Hit Clone Code (BAC ID) MKD10
Hit Gene Code At5g38710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Methylenetetrahydrofolate reductase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT027353 [GenBank]


Last Updated on 07.07.2016 14:03