SimpleSearch - Line and FST details


Line specific information

 
Line ID 925E10
Vector Used pAC161
Line Availability available as T3 set from NASC (N488762)
Segregation Analysis 50:36:26
Confirmed for Hit At5g15520
Parent of DUPLO pair none
Parent of pair(s) 2937, 6944

Gene hit At5g15520

 
Sequence (A. th genome BLAST matches underlined)
>77-K031610-022-925-E10-8409
TGTCTCATCCGCCGGAATGGGATCCACCCTCCACTAAGGACAAACATTGTGAAGACTGGT
CGTTTGAAGGAACTTGCTCCATATGACCCTGATTGG
GenBank Accession CT954621 [GenBank]
Graphic View Graphic view of gene At5g15520
Predicted Position of Insertion Chr5:5037888 - go to primer design
BLAST e Value 2e-20
Hit Clone Code (BAC ID) T20K14
Hit Gene Code At5g15520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S19e family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR817942 [GenBank]


Last Updated on 10.06.2021 13:37