SimpleSearch - Line and FST details


Line specific information

 
Line ID 941B08
Vector Used pAC161
Line Availability only available from NASC (N490260)
Segregation Analysis 50:41:31
Confirmed for Hit At2g31380
Parent of DUPLO pair 2501
Parent of pair(s) none

Gene hit At2g31380

 
Sequence (A. th genome BLAST matches underlined)
>58-K032903-022-941-B08-8409
CTAATCACCATATGGTTCTTATCCACTGGGAATCCGAGTTGCTCTTAATTCCACTAATTG
CAATCAAGAAGTGGAAAAGAATCACTTTGACCCATCTAATCAGCAGAGTCTCTCTAAACC
GCCAACTCAGCAACCCGCTGCTCCATCTCCTTTGTGGGCTACCGATGAATTCTTCAGCTA
CTCTGATCTTGACTGCAGTAATAAGGTGAGAACTGGTTTACCAAACTGATGAATACTCAA
ATATCCTGGTTAGTAACATGCTTAGACAAATATAATAATAATTTA
GenBank Accession CT955181 [GenBank]
Graphic View Graphic view of gene At2g31380
Predicted Position of Insertion Chr2:13382730 - go to primer design
BLAST e Value 2e-122
Hit Clone Code (BAC ID) T28P16
Hit Gene Code At2g31380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation salt tolerance homologue
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40