SimpleSearch - Line and FST details


Line specific information

 
Line ID 951A08
Vector Used pAC161
Line Availability only available from NASC (N491208)
Segregation Analysis 50:43:29
Confirmed for Hit At4g37490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g37490

 
Sequence (A. th genome BLAST matches underlined)
>57-K113507-0022-951-A08-8409
TGTAGTGATGAGTAAGGGACTGTGCTAACCTGTTGGCGTATCAGCAATGGAAGCAACGAG
AAGAACGGAGTGAGAGCACTACTACTGCAGCTTTACCAAAGAAATACTCCCAGGACCAAC
GCTTCGCTGTGGCTTTGATCCCTCCGGCCAAAGCTTTGTTGACCGGAACTGAATCTGCTT
AAGAGTTATGACCCCTTAAGAAGACTAAGAAGCTGAAGAACCACGCCTAACCTGCGCGGC
CGCTACTTGTTGTAATGATGAAAAAGGGACTGTGCAAAGCTGTTGGCGTATCAGCAATGG
AAGCAACAAGAAGAAGGGAGTGAGAGCAGTACTAAGGGAGCTTTACTAAAGAAATACTCC
AAGGACGAACGCTTCGCTGTGGCTTTGATCCCTCCGGCCAAAGCTTTGTTGACCGGAACT
GAATCTGCTTAGGAGTTAGGACCCTTTCCGATGACGAAGAAGCTGAAGAACCAAGCCTAA
CCTGCCCGGCCGCT
GenBank Accession HE666800 [GenBank]
Graphic View Graphic view of gene At4g37490
Predicted Position of Insertion Chr4:17622785 - go to primer design
BLAST e Value 9e-120
Hit Clone Code (BAC ID) F6G17
Hit Gene Code At4g37490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CYCLIN B1;1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HE666799 [GenBank] CU458333 [GenBank]


Last Updated on 31.08.2016 09:40