SimpleSearch - Line and FST details
Line specific information
Line ID | 956B12 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N491704) |
Segregation Analysis | 50:50:38 |
Confirmed for Hit | At4g30440 |
Parent of DUPLO pair | none |
Parent of pair(s) | 3883, 3983, 4036, 9890, 79756 |
Gene hit At4g30440
Sequence (A. th genome BLAST matches underlined) | >90-K104992-0022-956-B12-8409 AAGGATGTTTAGGATCTCTGGATTCATCGGGTAAAAGTACCGGGTCGGGTGGTA |
GenBank Accession | FR818735 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:14882319 - go to primer design |
BLAST e Value | 7e-22 |
Hit Clone Code (BAC ID) | F17I23 |
Hit Gene Code | At4g30440 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | UDP-D-glucuronate 4-epimerase 1 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | CT955699 [GenBank] FR818735 [GenBank] |
Last Updated on 10.06.2021 13:37 |