Sequences from confirmation amplicon


Sequence 19-K018911-022-250-D07C-DL91 is shown.

Sequence Name 19-K018911-022-250-D07C-DL91
GenBank Accession LN494560 [GenBank]
Line ID 250D07
Sequencing primer gene specific primer, DL91: 5'-TTGTTGCAGATTCGTAATGAAAAG-3'
Sequence (A. th genome BLAST matches underlined)
>19-K018911-022-250-D07C-DL91
GATATCTCGGCAATATGAGGAGAAAACCGCCAGTTCCATTCACTCACAAATTTCCTCATG
TAGACCCATTGGCCCTTCGCTTACTGCACCGTCTTCTTGCATTTGATCCCAAAGACCGTC
CCTCAGCTGAAGAGGTTAGCTCCTCTATACTTGTTTTTTCTAGCGTTTCCACTTCAAAAT
TTCAGAGCAGTTTCAATCGCTCTCAGAAAAGGAAACATTATATATACATGTGTGTGTGTA
TATACAGGCACTGGCAGATCCTTACTTCTATGGTCTGGCAAACGTTGATCGGGAACCATC
TACTCAACCGATTCCGAAACTCGAGTTTGAGTTTGAAAGAAGGAAGATAACAAAAGAAGA
TGTGAGAGAATTGATCTACAGAGAGGTACACTAATCTCTTACTGTTTTTGCTTCACTAAA
CTTGTTTGGATTGATTAATATGATGCATGGACAGGATATATTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACAT

Other confirmation sequences from the same hit.

Sequence Name 23-K018911-022-250-D07C-8409
GenBank Accession LN494560 [GenBank]
Line ID 250D07
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K018911-022-250-D07C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTCCATGCATCATATT
AATCAATCCAAACAAGTTTAGTGAAGCAAAAACAGTAAGAGATTAGTGTACCTCTCTGTA
GATCAATTCTCTCACATCTTCTTTTGTTATCTTCCTTCTTTCAAACTCAAACTCGAGTTT
CGGAATCGGTTGAGTAGATGGTTCCCGATCAACGTTTGCCAGACCATAGAAGTAAGGATC
TGCCAGTGCCTGTATATACACACACACATGTATATATAATGTTTCCTTTTCTGAGAGCGA
TTGAAACTGCTCTGAAATTTTGAAGTGGAAACGCTAGAAAAAACAAGTATAGAGGAGCTA
ACCTCTTCAGCTGAGGGACGGTCTTTGGGATCAAATGCAAGAAGACGGTGCAGTAAGCGA
AGGGCCAATGGGTCTACATGAGGAAATTTGTGAGTGAATGGAACTGGCGGTTTTCTCCTC
ATATTGCCGAGATATCTCCTCGCCTTTTCATTACGAA

Sequence Name 48-K118837-0022-250-D07C-13ah
GenBank Accession LN494560 [GenBank]
Line ID 250D07
Sequencing primer gene specific primer, 13ah: 5'-AGAATCCGGGAAATCAGTTTTACT-3'
Sequence (A. th genome BLAST matches underlined)
>48-K118837-0022-250-D07C-13ah
CTAGGCAGGAAGCGTGTTGGCGTTGAAGAGGTGAGCCTTTCTCACCCTTACCGTAATTTT
CCTCAAGATGAGCAAATTGTCTCTTAAAGCGATCAACACCACTGCATTTTCATTTAGATT
ACAAAATCTTTATCTTCACTTCTCATAATTCGTAGTAAATTTTGAACACGGATTCTAAAT
GTTTTTATATACCTTGGGTACATGAAGCTAGTCTGTTCTCCACCTCGAAGATATTCTTGC
AGCATCTGAGGATGATACTCTAATATCTGCATCACATTCAACTTTTGTAAGGATTACGAT
TACCCGATGGATACGTGCGAAAAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGACACGTTATTATAAT

Sequence Name 24-K118836-0022-250-D07C-8409
GenBank Accession LN494560 [GenBank]
Line ID 250D07
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K118836-0022-250-D07C-8409
TCATTGAATATATCCTTTTCGCCGTATCCATCGGGTAATCGTAATCCTTACAAAAGTTGA
ATGTGATGCAGATATTAGAGTATCATCCTCAGATGCTGCAAGAATATCTTCGAGGTGGAG
AACAGACTAGCTTCATGTACCCAAGGTATATAAAAACATTTAGAATCCGTGTTCAAAATT
TACTACGAATTATGAGAAGTGAAGATAAAGATTTTGTAATCTAAATGAAAATGCAGTGGT
GTTGATCGCTTTAAGAGACAATTTGCTCATCTTGAGGAAAATTACGGTAAGGGTGAGAAA
GGCTCACCTCTTCAACGCCAACACGCTTCCTTGCCTAGGTATACAATTTCGTTTGTTGGT
TTGTCAGTAAAACTGATTTCCACGGATTC


Last Updated on 07.07.2016 14:16