Sequences from confirmation amplicon


Sequence 24-K018475-022-123-D02C-8409 is shown.

Sequence Name 24-K018475-022-123-D02C-8409
GenBank Accession LN496801 [GenBank]
Line ID 123D02
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K018475-022-123-D02C-8409
CATGTAGATTTCTACATTATACATCCGATCCTCCAGATTCTCTTCTGTGTATTTCCTTAA
ATCTCCTCCTCTTTCTCTTTCCTATTTATTTATGTATCTCACTCACCGCTTCTGCCTCTC
TCTCTCTCTCTCTCTTATTTATGTAACTCCTCGTCTTCCTTCTTCACATTGATTTCTGCG
TCCTTTGACGTTCAAACTTTAAACGTTTCTTCATCTGTTTTGTTGTTTACTTTCCCGAGA
GAAAACAATGGCTCTCAGAGATTTATCTTCTTCTTTATCTTCTTCTTCTTCACCGGAGTT
ACATGTTCTTGCCGTTGATGATAGTTTCGTGGATCGTAAAGTTATTGAGAGATTGCTTAA
GATCTCTGCTTGTAAAGGTAAAAGGCAAAACTGTTTCTCTTTACGTTTTCTGCTTTTCTT
TTGTTTG

Other confirmation sequences from the same hit.

Sequence Name 23-K018475-022-123-D02C-DL29
GenBank Accession LN496801 [GenBank]
Line ID 123D02
Sequencing primer gene specific primer, DL29: 5'-AAACCAAACAAAAGAAAAGCAGAA-3'
Sequence (A. th genome BLAST matches underlined)
>23-K018475-022-123-D02C-DL29
TAAAGAGAAACAGTTTTGCCTTTTACCTTTACAAGCAGAGATCTTAAGCAATCTCTCAAT
AACTTTACGATCCACGAAACTATCATCAACGGCAAGAACATGTAACTCCGGTGAAGAAGA
AGAAGATAAAGAAGAAGATAAATCTCTGAGAGCCATTGTTTTCTCTCGGGAAAGTAAACA
ACAAAACAGATGAAGAAACGTTTAAAGTTTGAACGTCAAAGGACGCAGAAATCAATGTGA
AGAAGGAAGACGAGGAGTTACATAAATAAGAGAGAGAGAGAGAGAGAGGCAGAAGCGGTG
AGTGAGATACATAAATAAATAGGAAAGAGAAAGAGGAGGAGATTTAAGGAAATACACAGA
AGAGAATCTGGAGGATCGGATGTATAATGTAAAAATCTACGTGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATCTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATGGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCT


Last Updated on 06.12.2018 16:11