Sequences from confirmation amplicon


Confirmation sequences for line 038A07 and hit At4g07960 are shown.
Line ID 038A07
Locus At4g07960 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:4803463
Primers used for PCR EV42 - 8474, show primer details
   
Sequence Name 86-K037327-022-038-A07C-EV42
GenBank Accession LN514618 [GenBank]
Sequencing primer gene specific primer, EV42: 5'-TTTGTAACAACCCATTCATAAGCA-3'
Sequence (A. th genome BLAST matches underlined)
>86-K037327-022-038-A07C-EV42
ACCCGAGACCTTGCGTTGAACTTAGTCACAGACATTGTGTTCTCAAAGAGAAGGTACGGG
ACGATAAACGGAAACGACTTCGGGGCGGGAAGGATGTTGAGGAAAGACATTGTGGCAGGT
ATGTAGCAAACAACCCAAGCGGGAAGCTCAGCTTCGGGTACAAACATAGTCATTGGCAGG
ATAATACAAAAGAGAGTGAATGAGTAGAATGGCAAGATTAGCTTCCTCAGGAGAAAGAAG
AGGAATATCAAATTGAATTTCTTTCCTATGCTTATCTACAAAACAAACACACAACTATTA
ACCACATATAATACCAAAATTTAGAAAGTATTTTAGGTATTTTTTTTCTATATACCGTTG
CACAGGTTGTAAAAACGTTATTTTTTCATTGAATATAATTTAACATTAAATTAACCGTTA
GCGCACCTTTGATTTAATGACCGCGGGCAAACAAAGACGAAATAGTTGCATAGGACCTGA
ATGCCATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTA
TGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATG
TAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGA
TCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTT
CGACGTGTCTACATTCA
   
Sequence Name 93-K037327-022-038-A07C-8409
GenBank Accession LN515230 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>93-K037327-022-038-A07C-8409
GCCATTTCAATTGAATGGCATTCAGGTCCTATGCAACTATTTCGTCTCTTTTAGCCCGCG
GTCATTAAATCAAAGGTGCGCTAACGGTTCATTTAATGTTAAATTATATTCAATGAAAAA
ATAACGTTTTTACAACCTGTGCAACGGTATATAGAAAAAAAATACCTAAAATACTTTCTA
AATTTTGGTATTATATGTGGTTAATAGTTGTGTGTTTGTTTTGTAGATAAGCATAGGAAA
GAAATTCAATTTGATATTCCTCTTCTTTCTCCTGAGGAAGCTAATCTTGCCATTCTACTC
ATTCACTCTCTTTTGTATTATCCTGCCAATGACTATGTTTGTACCCGAAGCTGAGCTTCC
CGCTTGGGTTGTTTGCTACATACCTGCCACAATGTCTTTCCTCAACATCCTTCCCGCCCC
GAAGTCGTTTCCGTTTATCGTCCCGTACCTTCTCTTTGAGAACACAATGTCTGTGACTAA
GTTCAACGCAATGGTCTCGGGTTTGTTTCAGCTAGGAAGTGCTTATGAATGGGTTGTTAC
AAAACGTTCTACGCCAACTCTCTATTCCTGTTATTCTTATTATTATATCTTTATATCGAC
ATGAC

Last Updated on 07.07.2016 14:16