Sequences from confirmation amplicon


Confirmation sequences for line 074B10 and hit At5g63390 are shown.
Line ID 074B10
Locus At5g63390 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:25390963
Primers used for PCR PH03 - 8474, show primer details
   
Sequence Name 41-K017448-022-074-B10C-PH03
GenBank Accession LN503897 [GenBank]
Sequencing primer gene specific primer, PH03: 5'-ATTGGTTGCAGCTGGACTAGTATT-3'
Sequence (A. th genome BLAST matches underlined)
>41-K017448-022-074-B10C-PH03
CAAGGCAACCGAGCTATACCAATAGACCAGCGTTTGTGACAATCGCTGCCTTGAGAAGCA
ATGAGCCTGACCTAGAAGAAACCTACAGACCTGTGTTTTCTATGTCGACACATACACTCC
GGGACAGGATAAGCTATCACGTCACGATCTCTCCGCCCTCTCCGTGACTCAGGATAGCCT
TGGGACTTACGGTGAAGCTTCCGAGTTAGAAAACTGAGCTCGGCATCTGAAACAGAAGAA
TTCTCCATTAAAGGAAGCATCGCTCTCTTATTAGGCATTATAAACTTCCTGTGTCCTACA
TAAGCTCTATTTCCCTGAGAGAAAAACAGAGTTTAAGAAAGAAACTTTGGAAAATCTCAA
AAGACTATTCTTCTGTGTTACCTGCATAGCTTTTGCCATGTTTCCACCATGGGAAGGAAT
AAAAACATCGCTGCTAAGTGATACAATGTAGTCAATAGCTGCTAAAGCTGAAGATCTATT
GGTGTAAGGCAAGAGCTCGCCTTTATGAGCCAATGTCTCCTTTATGAGAGTATCTGTTTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTC
CGCAGCGTTATTATAAAATGAAAGTACATTTTGATAA
   
Sequence Name 42-K017448-022-074-B10C-8409
GenBank Accession LN504288 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>42-K017448-022-074-B10C-8409
ATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAAACAGATACTCTCATAAAG
GAGACATTGGCTCATAAAGGCGAGCTCTTGCCTTACACCAATAGATCTTCAGCTTTAGCA
GCTATTGACTACATTGTATCACTTAGCAGCGATGTTTTTATTCCTTCCCATGGTGGAAAC
ATGGCAAAAGCTATGCAGGTAACACAGAAGAATAGTCTTTTGAGATTTTCCAAAGTTTCT
TTCTTAAACTCTGTTTTTCTCTCAGGGAAATAGAGCTTATGTAGGACACAGGAAGTTTAT
AATGCCTAATAAGAGAGCGATGCTTCCTTTAATGGAGAATTCTTCTGTTTCAGATGCCGA
GCTCAGTTTTCTAAC

Last Updated on 31.05.2018 12:55