Sequences from confirmation amplicon


Confirmation sequences for line 180A11 and hit At3g07390 are shown.
Line ID 180A11
Locus At3g07390 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:2365434
Primers used for PCR 42ms - 8474, show primer details
   
Sequence Name 67-K114263-0022-180-A11C-42ms
GenBank Accession LN511867 [GenBank]
Sequencing primer gene specific primer, 42ms: 5'-CTTAGTCCCCGTAGGGTTAATAGC-3'
Sequence (A. th genome BLAST matches underlined)
>67-K114263-0022-180-A11C-42ms
AGCGACGGAGAGAGATGAATTTGAGGAATTGTAGGTGTAATGGAGGTAGGAATTGAGTAC
CGGAAGGTCTTCGCAACTATCGAACGGACCGGCGGAGTTCAAGTTCTGTGATTTGCAAGC
CTGTTGTGAAATCGCCGGTGAGATTAGCGAGACGAAACAAGCAACGGCTAGGATTAGAAG
AGAAGAAGAAGAAGAAGCCATGGCTGAGTTCTGTTCTGGTGTGGTTTGGTGTTTGATAAG
AGGTATTTTAAGACACAGGGACATGTGATGTTTATATAGAAGGGCAATCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTC
   
Sequence Name 24-K114262-0022-180-A11C-8409
GenBank Accession LN497089 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>24-K114262-0022-180-A11C-8409
CTTCATATAAACATCACATGTCCCTGTGTCTAAAATACCTCTTATCACACTCCAAACCAC
ACCAGAACAGAACTCAGCCATGGCTTCTTCTTCTTCTTCTCTTCTAATCCTAGCCGTTGC
TTGTTTCGTCTCGCTAATCTCACCGGCGATTTCACAACAGGCTTGCAAATCACAGAACTT
GAACTCCGCCGGTCCGTTCGATAGTTGCGAAGACCTTCCGGTACTCAATTCCTACCTCCA
TTACACCTACAATTCCTCAAATTCATCTCTCTCCGTCGCTTTCGTCGCCACTCCATCTCA
AGCCAACGGTGGCTGGGTCGCTTGGGCTATTAACCCTACGGNGACTAA

Last Updated on 31.05.2018 12:55