Sequences from confirmation amplicon


Confirmation sequences for line 184F04 and hit At2g35240 are shown.
Line ID 184F04
Locus At2g35240 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14845891
Primers used for PCR CM08 - 8474, show primer details
   
Sequence Name 53-K021645-022-184-F04C-8409
GenBank Accession LN508011 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K021645-022-184-F04C-8409
ATTTACAGCTAAATTGTTGGCAGGTGAGTGTCTTTGTCATGTTCGTTAGTGTTATTCCTC
AGCTACTTCACTATAACAAACTGAATCTGATTGTTGTTTGGTTTAATAGTGAGGAAGAGG
CTAGAAAGAAGATCTATAATGTTTCGTGTGAGAGGTATTTTGGGTTTGGCTGTGAGATTG
ATGAGGAGACATCAAACAAACTCGAAGGTATCTTTTTGTAACACTTGTTGTGTATGATAC
TGTAGCATAGCACCCGATGATGTGAATGTAATTGATGGAATTGGGTCTTTTGTGAGTTTC
AGGACTTCCTGGTGTTCTGTTCGTGCTTCCGGACTCTTATGTTGATCCAGAGTTCAAGAT
TTACGGA
   
Sequence Name 54-K021645-022-184-F04C-CM08
GenBank Accession LN508343 [GenBank]
Sequencing primer gene specific primer, CM08: 5'-CTCCGTAATCTTTGAACTCTGGAT-3'
Sequence (A. th genome BLAST matches underlined)
>54-K021645-022-184-F04C-cm8
AGTCCTGAAACTCACAAAAGACCCAATTCCATCAATTACATTCACATCATCGGGTGCTAT
GCTACAGTATCATACACAACAAGTGTTACAAAAAGATACCTTCGAGTTTGTTTGATGTCT
CCTCATCAATCTCACAGCCAAACCCAAAATACCTCTCACACGAAACATTATAGATCTTCT
TTCTAGCCTCTTCCTCACTATTAAACCAAACAACAATCAGATTCAGTTTGTTATAGTGAA
GTAGCTGAGGAATAACACTAACGAACATGACAAAGACACTCACCTGCCAACAATTTTAGC
TTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
CATT

Last Updated on 31.05.2018 12:55