Sequences from confirmation amplicon


Confirmation sequences for line 368E07 and hit At4g03270 are shown.
Line ID 368E07
Locus At4g03270 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:1433260
Primers used for PCR JM07 - 8474, show primer details
   
Sequence Name 35-K023834-022-368-E07C-JM07
GenBank Accession LN501672 [GenBank]
Sequencing primer gene specific primer, JM07: 5'-GCTCCTAGAATCACATTCTCCATT-3'
Sequence (A. th genome BLAST matches underlined)
>35-K023834-022-368-E07C-JM07
CTATCATCTGAGCATCAAAAAACTCACCTTTCCACCTTGAAAAAAATCCAATGTTCAGAC
ACTTATCAACACTTTAAAACACATTCACATTATAAAGATTCATGAGTTTTAAGTTACCGG
AAGATCAGAAACAGACATGTCTGGTTTCCTCATTTTTGCAGACAAAGAGACACAAGAGAG
AGATATGAGCTTAAGAATCCAGGGCTTTGACTGCTGTTGACAAAACAATTTAGTCAAAGA
AAAAGAAAGAACAGCAATTGATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTA
TTTCGACGTGTCTACATTCACG
   
Sequence Name 61-K023834-022-368-E07C-8409
GenBank Accession LN510410 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>61-K023834-022-368-E07C-8409
AGATTTCCCGGAACATGAAGCCATCAATTGCTGTTCTTTCTTTTTCTTTGACTAAATTGT
TTTGTCAACAGCAGTCAAAGCCCTGGATTCTTAAGCTCATATCTCTCTCTTGTGTCTCTT
TGTCTGCAAAAATGAGGAAACCAGACATGTCTGTTTCTGATCTTCCGGTAACTTAAAACT
CATGAATCTTTATAATGTGAATGTGTTTTAAAGTGTTGATAAGTGTCTGAACATTGGATT
TTTTTCAGGTGGAAGGTGAGTTTTTTGATGCTCAGATGATAGAGAGAATGGAGAATGTGA
TTCTAGGA

Last Updated on 07.07.2016 14:16