Sequences from confirmation amplicon


Confirmation sequences for line 570H02 and hit At4g18020 are shown.
Line ID 570H02
Locus At4g18020 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:10006815
Primers used for PCR NA25 - 8474, show primer details
   
Sequence Name 44-K101564-0022-570-H02C-8409
GenBank Accession LN505128 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>44-K101564-0022-570-H02C-8409
CTTTACATTGAAATATCCTGAATAAACAACAAAATTAGACAGAATAAAGATACAAGAAAA
GTAAATATTCAAAAGGTGTGTGTATTATTGATGAGATAAGAATAATTCATGAGGAACTTG
ATTTTGTTATTTATAAAGAGTGGACCACCATGCCATGAAATCTAACAAAGCTTTTGAATC
ATTTAAGAGTGAATATATTATTAGTTTAGTGTTGTTTAACTCGTGCATGCAGTGATTAGT
TAACTTAACAACACAGACTAATGACCTTTAACAAATACTAAAACATAGGCTTATGACAAC
TAATGAAGGAGAAAGGCA
   
Sequence Name 44-K101577-0022-570-H02C-NA25
GenBank Accession LN505129 [GenBank]
Sequencing primer gene specific primer, NA25: 5'-TTGCCTTTCTCCTTCATTAGTTGT-3'
Sequence (A. th genome BLAST matches underlined)
>44-K101577-0022-570-H02C-NA25
TAGTCTGTGTTGTTAGTTAACTAATCACTGCATGCACGAGTTAAACAACACTAAACTAAT
AATATATTCACTCTTAAATGATTCAAAAGCTTTGTTAGATTTCATGGCATGGTGGTCCAC
TCTTTATAAATAACAAAATCAAGTTCCTCATGAATTATTCTTATCTCATCAATAATACAC
ACACCTTTTGAATATTTACTTTTCTTGTATCTTTATTCTGTCTAATTTTGTTGTTTATTC
AGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATNTCCGC

Last Updated on 31.05.2018 12:55