DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_001468c
Line Availability available from NASC (N665092) and ABRC (SALK_001468c)
Confirmed for Hit At2g46470
Parent of DUPLO pair 969
Parent of pair(s) none

Gene hit At2g46470

 
Sequence (A. th genome BLAST matches underlined) 
GTGAAGTCTTAGCACGTAATGGGACTAATAAGCTGACNCNTCNNNGATTCCACGCNAGCA
AGTANCCATAACTAAAATCCTGCTAACAAAAAGAGAGTTCTTATAGCAACAACAAATACA
CAAGAGATAAAATTCGAATCAAAACCAGTCTAATAAGTTCCTCAAAGATCATCAATTTCT
GCTTTTACTTGTACAGATAAGGATTCATTTCAAGCT
GenBank Accession ED581613 [GenBank]
Graphic View Graphic view of gene At2g46470
Predicted Position of Insertion Chr2:19072682 - go to primer design
BLAST e Value 1e-86
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation inner membrane protein OXA1-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED581613 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37