DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_005087c
Line Availability available from NASC (N654478) and ABRC (SALK_005087c)
Confirmed for Hit At1g02820
Parent of DUPLO pair 1470
Parent of pair(s) none

Gene hit At1g02820

 
Sequence (A. th genome BLAST matches underlined) 
GAAAAGCTCTCGAACGCCGGTTTCAGGTAACATCTGTTTCTGAAACAAAAACGTTATGTA
TTGCTCTGTTTTCTCGTCGCTTTAACAAAACGCTGACGTTTTGGATTTTGGATTCTCTTC
AGACGAGGGTTTGCCGCCGCAGCCAAAACGGCGTTAGATGGAAGCGTTTCGACCGCGGAG
ATGAAGAAGAGAGCTGGGGAAGCT
GenBank Accession ED606296 [GenBank]
Graphic View Graphic view of gene At1g02820
Predicted Position of Insertion Chr1:624256 - go to primer design
BLAST e Value 1e-110
Hit Clone Code (BAC ID) F22D16
Hit Gene Code At1g02820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Late embryogenesis abundant 3 (LEA3) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37