DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_016341
Line Availability available from NASC (N516341) and ABRC (SALK_016341)
Confirmed for Hit At2g43500
Parent of DUPLO pair 11970
Parent of pair(s) none

Gene hit At1g10280

 
Sequence (A. th genome BLAST matches underlined) 
TGTCGGCCCAAAAAGTTGACGACCCCTAACCCCCGTCCCATTTAACCGGGGGCCCTCCGG
CCCATTACCTTAAACCCATTAGATTTTTCCCTTCTGGCAAGATCTGCGGATTTTGACCTC
TTTTTGCTTTTCAACGGGGAGTTTTAAACTCA
GenBank Accession ED576046 [GenBank]
Graphic View Graphic view of gene At1g10280
Predicted Position of Insertion Chr1:3369339 - go to primer design
BLAST e Value 7e-29
Hit Clone Code (BAC ID) F14N23
Hit Gene Code At1g10280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At2g43500

 
Sequence (A. th genome BLAST matches underlined) 
TCCATGACAGCACAACAAGATGTCCCAGAAGCT
GenBank Accession BH747347 [GenBank]
Graphic View Graphic view of gene At2g43500
Predicted Position of Insertion Chr2:18063592 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) T1O24
Hit Gene Code At2g43500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant regulator RWP-RK family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37