DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_045920c
Line Availability available from NASC (N678433) and ABRC (SALK_045920c)
Confirmed for Hit At3g17910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g17910

 
Sequence (A. th genome BLAST matches underlined) 
AATCTGAGGATAGTAAGCATCAATTTCTGAAAAGCTAAGCCCTTTTTGTTTCAGAGAACA
AACGAGGGTCTAAGTGGTCACAATTGTTGTTGTTCTTGCCTGGAGCGATTACCTTTGGTC
TCGGG
GenBank Accession BH748387 [GenBank]
Graphic View Graphic view of gene At3g17910
Predicted Position of Insertion Chr3:6133817 - go to primer design
BLAST e Value 2e-65
Hit Clone Code (BAC ID) MEB5
Hit Gene Code At3g17910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Surfeit locus 1 cytochrome c oxidase biogenesis protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37