DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_050877c
Line Availability available from NASC (N662443) and ABRC (SALK_050877c)
Confirmed for Hit At2g45100
Parent of DUPLO pair none
Parent of pair(s) 1051, 60130

Gene hit At2g45100

 
Sequence (A. th genome BLAST matches underlined) 
TGCCGCGTAACCGTCTCCCTCTTGCCCGGTTTCAACCATCTCATGCTCCTCCTTCTTCTT
CTTCTCCATCACTGTCTCGGTTTTCGATCTCTTGGGTGATTTCTCAACTGACGCATCAAA
AAGCTCCTCCCAATAATCTCAGTTAATATCGCGAAATTTCTGTATAACAACTTAAAGACT
CAAAA
GenBank Accession BH755542 [GenBank]
Graphic View Graphic view of gene At2g45100
Predicted Position of Insertion Chr2:18595465 - go to primer design
BLAST e Value 6e-70
Hit Clone Code (BAC ID) T14P1
Hit Gene Code At2g45100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclin/Brf1-like TBP-binding protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37