DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_113472c
Line Availability available from NASC (N664827) and ABRC (SALK_113472c)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64840

 
Sequence (A. th genome BLAST matches underlined) 
GGAGCTAACCCTTATTCCGGTATCAACTTACTAAGCTTAGCATCAACGAAATCTAAATTT
ACAGCCTGAGCTCGTGTCTGGCACAAATCGAATGTTTCTTATAACCCTTCCCATTAGATC
CAAATCATCA
GenBank Accession BZ379517 [GenBank]
Graphic View Graphic view of gene At5g64840
Predicted Position of Insertion Chr5:25918945 - go to primer design
BLAST e Value 1e-27
Hit Clone Code (BAC ID) MXK3
Hit Gene Code At5g64840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation general control non-repressible 5
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37