SimpleSearch - Line and FST details


Line specific information

 
Line ID 011H11
Vector Used pAC106
Line Availability available from GABI-Kat
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g41300

 
Sequence (A. th genome BLAST matches underlined)
>011H11-LB-5-16515223-R-150-a
ACAACTGGTCTAGCTTCAGACACAGTCTATGGAATGTTCTTATGCACAGGAGACGTCAAC
ATAACAACGTGCAACAACTGCGTCAAGAATGCAACAATCGAGATTGTCAAAAACTGTACT
AACCATCGAGAAGCAATCATTTACTACATC
GenBank Accession KG780079 [GenBank]
Graphic View Graphic view of gene At5g41300
Predicted Position of Insertion Chr5:16515223 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) K1O13
Hit Gene Code At5g41300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Receptor-like protein kinase-related family protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit MVA11

 
Sequence (A. th genome BLAST matches underlined)
>011H11-LB-3-11997099-F-150-a
TCTACTGTTATATAACATGAACAAGGAAGGAGAAGAAGAAACAATCCAATCAGTCGGATT
TAATAATTAAGCGTGTAAACTTGACTAGGCTAAGCGTATAAACTTGACTAGGCTATATAT
ACTCAAATACATGCACTAAAATCCATTTTG
GenBank Accession KG780078 [GenBank]
Graphic View Graphic view of sequence KG780078 of line 011H11
Predicted Position of Insertion Chr3:11997099 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) MVA11
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g01020

 
Sequence (A. th genome BLAST matches underlined)
>011H11-LB-1-9173-R-150-a
TAAATAAGAAAGGTAAATAAATCTTCGTTTGCCACACCAAACAAAAAAAACTCCTTTTGT
TGCATGTAATTAGCATATGGCTACAAAATGAAAGATTTGACAATGAGGTTTAGATAAAAT
AGTTTCCTTTCAATATAAGTAAACTCAACA
GenBank Accession KG780077 [GenBank]
Graphic View Graphic view of gene At1g01020
Predicted Position of Insertion Chr1:9173 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) T25K16
Hit Gene Code At1g01020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARV1 family protein
Insertion Classification Promoter
Confirmation Status unknown
Other FSTs Supporting this Hit KG780077 [GenBank]


Last Updated on 31.08.2016 09:40