SimpleSearch - Line and FST details


Line specific information

 
Line ID 073C12
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g09830

 
Sequence (A. th genome BLAST matches underlined) 
>073C12-LB-4-6188561-R-150-a
TCAACTCAAAAAATTGTTTACAAAAATTTGCTAAAACTCTCTTCAAAAATATTTAACACA
ATTAACAAAAACAAATTCCAAAACTTTGTAATAAGACAATAAGTAATCAATCTCCAAAAA
AAAAAAAAACAAAAAAAAAAAAACCTTGTT
GenBank Accession KG780922 [GenBank]
Graphic View Graphic view of gene At4g09830
Predicted Position of Insertion Chr4:6188561 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F17A8
Hit Gene Code At4g09830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear receptor family 2 group C protein
Insertion Classification Promoter
Confirmation Status unknown
Other FSTs Supporting this Hit KG780922 [GenBank]

Gene hit At3g24200

 
Sequence (A. th genome BLAST matches underlined) 
>073C12-LB-3-8751793-F-150-a
TTATAAGCAGACCCGAATTACGGTTTGATCCTTGCCTCGGTTGAAACGAAACGGCGTCGT
TTGTTTGAGACCACTTTCGTTGCAAATACTCCGCCTGAAGAAAGACCTTCTCTGTCAGTT
AGAGGCTTTAGTTTCGTCCTCGTCGTCCTT
GenBank Accession KG780921 [GenBank]
Graphic View Graphic view of gene At3g24200
Predicted Position of Insertion Chr3:8751793 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) MUJ8
Hit Gene Code At3g24200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD/NAD(P)-binding oxidoreductase family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 10.06.2021 13:37