SimpleSearch - Line and FST details


Line specific information

 
Line ID 122F10
Vector Used pAC161
Line Availability only available from NASC (N411686)
Segregation Analysis 50:33:30
Confirmed for Hit At2g16940
Parent of DUPLO pair 1842
Parent of pair(s) none

Gene hit At2g16940

 
Sequence (A. th genome BLAST matches underlined)
>78-K012551-022-122-F10-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACATTGAATATAGTCCTGAACTCTT
ACGATCACTCCGATTACTATAAAAGCAGCTGACCTTATACGCATGTGTCGGATACCACCA
CTTTTTTGAGATGACAGGAAGCATATACGTGGCTTCAAACGAGATTAGCTTTCACTCACA
TGCTATGGGAATCTTGCTATAACGATGAATAACACTGAGCGATAAAGATAAACCGGTCGA
GCAGATAACAAGCACACTACATAAACTTAATACACAGTTTCTAAAGTGTGAACTATGGAG
AAATACATATAGTGTGAAAGTGAACACCATCTACGAAGTAGCACCTACCAGAAAGAAGGC
ACCAGATCTTAACGGAAATGGCCTATGATAAAGAGGATGAGACATTTTGGAGAACAAGGT
TGAGATAGATACTAGAGAGAGAGAAGGATCGCCTGCGATCTCTATCCCGGGCCTTGCTCT
CTCTTTCCTTAGGTTCTATTGCCAAGCTCTTTTCTCTTTCCTGACTCCGATGTCGCTCTG
ATCGACTTCTACTTCTTCGTGACCGATCTTTTTCATGGCCACGCCCTGTACTGTCTAGAT
CCTTATCTCTGGCCCTCTCTCTATCTGTCCCATTGCTTTGCTCCTTTATCTACATCCTTT
TCACGAACTCTATCTCTGTGGCTCCTGGCTACTCTATGGCCAACCCTCTCTCTGGCCCTA
GAACGGGCAACGGTGAGGCGATCTCGACCGCTTAAAAACCGCCGACATTCCCCATNTTCA
TCCCTTTCCTTTTTTTGGGACCCCCTAGGCCGGGGAGCCCCACTCCTCTTTTTCCCTTCA
AAATGGACTTT
GenBank Accession AL764193 [GenBank]
Graphic View Graphic view of gene At2g16940
Predicted Position of Insertion Chr2:7346177 - go to primer design
BLAST e Value 3e-119
Hit Clone Code (BAC ID) F12A24
Hit Gene Code At2g16940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Splicing factor, CC1-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T24C20

 
Sequence (A. th genome BLAST matches underlined)
>78-K028302-022-122-F10-8409
ATGAAGCCTTTACAATTGAATAATATCCTGAACACTATACGATTCTCTTGGATCCTTAAA
TGCAGTGTCGATTCCTCATGGATCAATTTCAGTTCATTTTTTGCACCGGAGCTTGGATAG
CAAGGCATTAGACGGGATTAGCTTTCATCCATGCTAGAGCTTATTTCCTTCCAATGATGT
ATAACCGTATGGGATCCTCCCTATAGTGAGACNTATTACTCACT
GenBank Accession CR770182 [GenBank]
Graphic View Graphic view of sequence CR770182 of line 122F10
Predicted Position of Insertion Chr3:17860356 - go to primer design
BLAST e Value 1e-55
Hit Clone Code (BAC ID) T24C20
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit CR934642 [GenBank] CR934642 [GenBank]


Last Updated on 31.08.2016 09:40