SimpleSearch - Line and FST details


Line specific information

 
Line ID 198D07
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At1g80990

 
Sequence (A. th genome BLAST matches underlined)
>52-K014762-022-198-D07-8409
TTATTAACTTTTCTCCTTTAACGACTCCTTACGGGACTTTAATTTCTGCCGTCAACCTCT
TCAAGTCACTCAATCTATCCATACCTTGCAGAGCCTGAGATTAAAAGAGGGATTCTAAGA
TTAACAGAGGGATTCTTGAATGAATTTGAGAGAAATGCAAAAAAAATGGCGAAAGCGGAA
TGGCCCGAAAAGCCACTGCCTCTGTATTTATATACGTTCACGTGTGTGTTACGCCCAATT
TTAAAAATGGGTCAAGGCCCAATTGTAAATGGCTTCATGTCCCGGAAATATCCATGGATC
AACAATGAGTATGATGGTCAATATGGAGAAAAAAAAAGAGTAATTACCAATTTTTTTTCA
ATTTAAAAATGTAGATGTCTCGCACGTTATNNAAANNNNCCNTCTTCNCTTCGCCCCCCG
TCAACCATCCCCCCCATTACCTATTTTATCCCCATCCCCACCACCCACCCACCCCGAATC
CTCTATCTCTCACCGCCAAAACTTCAAAATC
GenBank Accession AL760498 [GenBank]
Graphic View Graphic view of gene At1g80990
Predicted Position of Insertion Chr1:30424493 - go to primer design
BLAST e Value 1e-99
Hit Clone Code (BAC ID) F23A5
Hit Gene Code At1g80990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation XH domain-containing protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g38520

 
Sequence (A. th genome BLAST matches underlined)
>52-K025984-022-198-D07-8409
TCCCTACCAAGTGTGAGTATATATATCTCCCGTATGGGATCCTCCCTATAATGAGAGACG
GATGAGATCCTTTTTTACACTAGGTCGTAATTTACGGAATCCTCCCTGTATTAGAGATGC
TTACCTCTTGATTCCTTGGATAACCAAATCTATGAAACAGATGGTTGTGTAGTATTTATA
GGTTTTGGAAGCCGGCTAACCAAGTCTAAAATATAAATAGGTGTGTAGTATGATGCATAT
CTGACTGAAATCTAATCCGTCCGTATTAACTTCATCATTCACTATTGCGGACTAATATGC
ATTATCATACATTAAAAGATTTCACTAGT
GenBank Accession CR396357 [GenBank]
Graphic View Graphic view of gene At5g38520
Predicted Position of Insertion Chr5:15421538 - go to primer design
BLAST e Value 3e-53
Hit Clone Code (BAC ID) MBB18
Hit Gene Code At5g38520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 860H03

Gene hit T25K16

 
Sequence (A. th genome BLAST matches underlined)
>198D07-LB-1-1043-R-150-a
TTGTGAAGCAGAAAGTGGCAACACCCCCCACCTCCCCCCCCCCCCCCCACCCCCCAAATT
GAGAAGTCAATTTTATATAATTTAATCAAATAAATAAGTTTATGGTTAAGAGTTTTTTAC
TCTCTTTATTTTTCTTTTTCTTTTTGAGAC
GenBank Accession KG782718 [GenBank]
Graphic View Graphic view of sequence KG782718 of line 198D07
Predicted Position of Insertion Chr1:1043 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) T25K16
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 10.06.2021 13:37