SimpleSearch - Line and FST details


Line specific information

 
Line ID 318E10
Vector Used pAC161
Line Availability available as T3 set from NASC (N430490)
Segregation Analysis 50:23:16
Confirmed for Hit At2g47640
Parent of DUPLO pair none
Parent of pair(s) 6799

Gene hit At2g47640

 
Sequence (A. th genome BLAST matches underlined)
>77-K015855-022-318-E10-8409
TTTCCCGGACTGTAGATTTACCAATGTAAGCTTCCTTCTNATTTCTCTCGCTACTGCTTT
TCTCGATTCGCTGTTTGCCATAATTCATCTACTGTTTCCAGTTTCATCAATCTTAGCTGT
CTCTATGGGATCCTCCCTATAGTGAGA
GenBank Accession AL949163 [GenBank]
Graphic View Graphic view of gene At2g47640
Predicted Position of Insertion Chr2:19537523 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Small nuclear ribonucleoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37