SimpleSearch - Line and FST details


Line specific information

 
Line ID 340D03
Vector Used pAC161
Line Availability available as T3 set from NASC (N432583)
Segregation Analysis 100:98:85
Confirmed for Hit At1g77950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77950

 
Sequence (A. th genome BLAST matches underlined)
>20-K016152-022-340-D03-8409
ATTTCATTACTTTTTTCTTTTACTAGTTGTGGGATCATACTTCATCGTCTTTTTCAAAAG
ACAGTACTATGAGATCCCCTGTATACGTCGAGATCAACAAACCTCGGTTTATTCCTCATT
AATCCTTATAATAAATTTGTTTCATCTTGTTTATATGTTTTAAAAAACAAAATCTGCTAT
GGGATCCTCCCCTATAGG
GenBank Accession AL952015 [GenBank]
Graphic View Graphic view of gene At1g77950
Predicted Position of Insertion Chr1:29308739 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) F28K19
Hit Gene Code At1g77950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 67
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 340D03 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37