SimpleSearch - Line and FST details


Line specific information

 
Line ID 826B10
Vector Used pAC106
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g06340

 
Sequence (A. th genome BLAST matches underlined)
>74-K025534-022-826-B10-8409
TAAATACTTCATTGTTGCTAGAGTAAGAAACTGTTGAAACAAGTTGGTGAAAACCCCTTT
TTGGCCATATTCTACTCGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR361107 [GenBank]
Graphic View Graphic view of gene At3g06340
Predicted Position of Insertion Chr3:1920337 - go to primer design
BLAST e Value 7e-26
Hit Clone Code (BAC ID) F28L1
Hit Gene Code At3g06340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNAJ heat shock N-terminal domain-containing protein
Insertion Classification TS2TE (3')
Confirmation Status unknown
Other FSTs Supporting this Hit CR361106 [GenBank]


Last Updated on 10.06.2021 13:37